Online Inquiry
ITGA2 cDNA ORF Clone, Human, N-FLAG tag
SPD-08819
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Integrin |
Gene Abbr. | ITGA2 |
Gene ID | 3673 |
Full Name | integrin subunit alpha 2 |
Alias | BR, CD49B, GPIa, HPA-5, VLA-2 |
Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α1 (CD49a, VLA-1, ITGA1) pairs with integrin β1 to form an α1β1 dimer on the cell surface. This integrin dimer plays important roles in colorectal cancer and pancreatic cancer cell proliferation, migration, and metastasis. The cytoplasmic tail of integrin α1 activates ERK and FAK/Src signaling to promote these biological processes. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) with N terminal Flag tag. |
NCBI Ref Seq | NM_002203.3 |
RefSeq ORF Size | 3546 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 759C/T,825G/A,3252C/T not causing the amino acid variation. |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 3.55kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.