Online Inquiry
ITGA1 cDNA ORF Clone, Rhesus, C-Myc tag
SPD-08747
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus integrin, alpha 1 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | Integrin |
Gene Abbr. | ITGA1 |
Gene ID | 703456 |
Full Name | integrin subunit alpha 1 |
Introduction | Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α1 (CD49a, VLA-1, ITGA1) pairs with integrin β1 to form an α1β1 dimer on the cell surface. This integrin dimer plays important roles in colorectal cancer and pancreatic cancer cell proliferation, migration, and metastasis. The cytoplasmic tail of integrin α1 activates ERK and FAK/Src signaling to promote these biological processes. In immune systems, integrin α1 expression defines a tissue-resident cytotoxic T cell population contributing to both cancer immunity and vitiligo, an autoimmune disease. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus integrin, alpha 1 with C terminal Myc tag. |
NCBI Ref Seq | XM_001094788.2 |
RefSeq ORF Size | 3540 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.