ITGA1 cDNA ORF Clone, Rhesus, C-FLAG tag - CD BioSciences

service-banner

ITGA1 cDNA ORF Clone, Rhesus, C-FLAG tag

ITGA1 cDNA ORF Clone, Rhesus, C-FLAG tag

SPD-08745

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus integrin, alpha 1 with C terminal Flag tag.
Target Information
Species Rhesus
Target Name Integrin
Gene Abbr. ITGA1
Gene ID 703456
Full Name integrin subunit alpha 1
Introduction Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling).Integrin α1 (CD49a, VLA-1, ITGA1) pairs with integrin β1 to form an α1β1 dimer on the cell surface. This integrin dimer plays important roles in colorectal cancer and pancreatic cancer cell proliferation, migration, and metastasis. The cytoplasmic tail of integrin α1 activates ERK and FAK/Src signaling to promote these biological processes. In immune systems, integrin α1 expression defines a tissue-resident cytotoxic T cell population contributing to both cancer immunity and vitiligo, an autoimmune disease.
Product Details
Description Full length Clone DNA of Rhesus integrin, alpha 1 with C terminal Flag tag.
NCBI Ref Seq XM_001094788.2
RefSeq ORF Size 3540 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.