IRS1 Knockout Cell Line - CD BioSciences

service-banner

IRS1 Knockout Cell Line

IRS1 Knockout Cell Line

SPL-01739

Size Price
1 Unit Online Inquiry
Description
16bp deletion
Target Information
Target Name IRS-1
Gene Abbr. IRS1
Gene ID 3667
Full Name insulin receptor substrate 1
Alias HIRS-1
Species Human
Genomic Locus chr2:226798538
Transcript NM_005544
WT Expression Level 0.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of IRS1.
Description 16bp deletion
Parental Cell Line C631
Guide RNA Sequence CTCAAGGGGGATCGAGCGTT
PCR Primer Forward: GTCACCGTAGCTCAAGTCCTC
Reverse: CATGCACAAACGCTTCTTCGTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.