Online Inquiry
IRS1 cDNA ORF Clone, Human, untagged
SPD-09380
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human insulin receptor substrate 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | IRS-1 |
| Gene Abbr. | IRS1 |
| Gene ID | 3667 |
| Full Name | insulin receptor substrate 1 |
| Alias | HIRS-1 |
| Introduction | Insulin receptor substrate 1 (IRS-1) is one of the major substrates of the insulin receptor kinase. IRS-1 contains multiple tyrosine phosphorylation motifs that serve as docking sites for SH2-domain containing proteins that mediate the metabolic and growth-promoting functions of insulin. IRS-1 also contains over 30 potential serine/threonine phosphorylation sites. Ser307 of IRS-1 is phosphorylated by JNK and IKK while Ser789 is phosphorylated by SIK-2, a member of the AMPK family. The PKC and mTOR pathways mediate phosphorylation of IRS-1 at Ser612 and Ser636/639, respectively. Phosphorylation of IRS-1 at Ser1101 is mediated by PKCθ and results in an inhibition of insulin signaling in the cell, suggesting a potential mechanism for insulin resistance in some models of obesity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human insulin receptor substrate 1. |
| NCBI Ref Seq | NM_005544.2 |
| RefSeq ORF Size | 3729 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6kb + 3.73kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.