IRAK4 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

IRAK4 cDNA ORF Clone, Human, C-Myc tag

IRAK4 cDNA ORF Clone, Human, C-Myc tag

SPD-09351

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin-1 receptor-associated kinase 4 with C terminal Myc tag.
Target Information
Species Human
Target Name IRAK4
Gene Abbr. IRAK4
Gene ID 51135
Full Name interleukin 1 receptor associated kinase 4
Alias IMD67, IPD1, IRAK-4, NY-REN-64, REN64
Introduction Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is a serine/threonine-specific kinase that can be coprecipitated in an IL-1-inducible manner with the IL-1 receptor. The mammalian family of IRAK molecules contains four members (IRAK1, IRAK2, IRAK3/IRAK-M, and IRAK4). The binding of IL-1 to IL-1 receptor type I (IL-1RI) initiates the formation of a complex that includes IL-1RI, AcP, MyD88, and IRAKs. IRAK undergoes autophosphorylation shortly after IL-1 stimulation. The subsequent events involve IRAK dissociation from the IL-1RI complex, its ubiquitination, and its association with two membrane-bound proteins: TAB2 and TRAF6. The resulting IRAK-TRAF6-TAB2 complex is then released into the cytoplasm where it activates protein kinase cascades, including TAK1, IKKs, and the stress-activated kinases.Upon IL-1R/TLR (Toll-Like Receptor) ligation, IRAK1 and IRAK4 are rapidly recruited to the receptor by the adaptor MyD88. IRAK1 is phosphorylated by IRAK4 at Thr209 and Thr387 followed by sequential autohyperphosphorylation in various domains.
Product Details
Description Full length Clone DNA of Human interleukin-1 receptor-associated kinase 4 with C terminal Myc tag.
NCBI Ref Seq NM_016123.3
RefSeq ORF Size 1428 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.43kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.