Online Inquiry
IRAK4 cDNA ORF Clone, Human, C-His tag
SPD-09350
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin-1 receptor-associated kinase 4 with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IRAK4 |
Gene Abbr. | IRAK4 |
Gene ID | 51135 |
Full Name | interleukin 1 receptor associated kinase 4 |
Alias | IMD67, IPD1, IRAK-4, NY-REN-64, REN64 |
Introduction | Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is a serine/threonine-specific kinase that can be coprecipitated in an IL-1-inducible manner with the IL-1 receptor. The mammalian family of IRAK molecules contains four members (IRAK1, IRAK2, IRAK3/IRAK-M, and IRAK4). The binding of IL-1 to IL-1 receptor type I (IL-1RI) initiates the formation of a complex that includes IL-1RI, AcP, MyD88, and IRAKs. IRAK undergoes autophosphorylation shortly after IL-1 stimulation. The subsequent events involve IRAK dissociation from the IL-1RI complex, its ubiquitination, and its association with two membrane-bound proteins: TAB2 and TRAF6. The resulting IRAK-TRAF6-TAB2 complex is then released into the cytoplasm where it activates protein kinase cascades, including TAK1, IKKs, and the stress-activated kinases.Upon IL-1R/TLR (Toll-Like Receptor) ligation, IRAK1 and IRAK4 are rapidly recruited to the receptor by the adaptor MyD88. IRAK1 is phosphorylated by IRAK4 at Thr209 and Thr387 followed by sequential autohyperphosphorylation in various domains. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin-1 receptor-associated kinase 4 with C terminal His tag. |
NCBI Ref Seq | NM_016123.3 |
RefSeq ORF Size | 1383 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.