Irak3 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Irak3 cDNA ORF Clone, Mouse, N-FLAG tag

Irak3 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-09363

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin-1 receptor-associated kinase 3 with N terminal Flag tag.
Target Information
Species Mouse
Target Name IRAK-M
Gene Abbr. Irak3
Gene ID 73914
Full Name interleukin-1 receptor-associated kinase 3
Alias 4833428C18Rik, AI563835, IRA, IRAK-M
Introduction Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is a serine/threonine-specific kinase that can be coprecipitated in an IL-1-inducible manner with the IL-1 receptor. The mammalian family of IRAK molecules contains four members (IRAK1, IRAK2, IRAK3/IRAK-M, and IRAK4). The binding of IL-1 to IL-1 receptor type I (IL-1RI) initiates the formation of a complex that includes IL-1RI, AcP, MyD88, and IRAKs. IRAK undergoes autophosphorylation shortly after IL-1 stimulation. The subsequent events involve IRAK dissociation from the IL-1RI complex, its ubiquitination, and its association with two membrane-bound proteins: TAB2 and TRAF6. The resulting IRAK-TRAF6-TAB2 complex is then released into the cytoplasm where it activates protein kinase cascades, including TAK1, IKKs, and the stress-activated kinases.Unlike IRAK1 and IRAK4, IRAK2 and IRAK-M do not have significant kinase activity although they can still activate NF-κB when overexpressed. Expression of IRAK-M is more restricted compared to other family members with highest levels of expression occurring in monocytes/macrophages. Studies from IRAK-M knockout mice suggest that IRAK-M may play a role as a negative regulator of Toll-like receptor signaling and innate immune responses by preventing the dissociation of IRAK1 and IRAK4 from MyD88 and the subsequent formation of its complex with TRAF6.
Product Details
Description Full length Clone DNA of Mouse interleukin-1 receptor-associated kinase 3 with N terminal Flag tag.
NCBI Ref Seq NM_028679.3
RefSeq ORF Size 1830 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.