Irak2 cDNA ORF Clone, Mouse, C-Myc tag - CD BioSciences

service-banner

Irak2 cDNA ORF Clone, Mouse, C-Myc tag

Irak2 cDNA ORF Clone, Mouse, C-Myc tag

SPD-09330

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin-1 receptor-associated kinase 2 with C terminal Myc tag.
Target Information
Species Mouse
Target Name IRAK2
Gene Abbr. Irak2
Gene ID 108960
Full Name interleukin-1 receptor-associated kinase 2
Alias 6330415L08Rik, AI649099, IRA, IRAK-2
Introduction Interleukin-1 (IL-1) receptor-associated kinase (IRAK) is a serine/threonine-specific kinase that can be coprecipitated in an IL-1-inducible manner with the IL-1 receptor. The mammalian family of IRAK molecules contains four members (IRAK1, IRAK2, IRAK3/IRAK-M, and IRAK4). The binding of IL-1 to IL-1 receptor type I (IL-1RI) initiates the formation of a complex that includes IL-1RI, AcP, MyD88, and IRAKs. IRAK undergoes autophosphorylation shortly after IL-1 stimulation. The subsequent events involve IRAK dissociation from the IL-1RI complex, its ubiquitination, and its association with two membrane-bound proteins: TAB2 and TRAF6. The resulting IRAK-TRAF6-TAB2 complex is then released into the cytoplasm where it activates protein kinase cascades, including TAK1, IKKs, and the stress-activated kinases.Unlike IRAK1 and IRAK4, IRAK2 and IRAK-M do not have significant kinase activity although they can still activate NF-κB when overexpressed. Antisense oligonucleotide depletion of IRAK2 can inhibit IL-1 mediated NF-κB activation.
Product Details
Description Full length Clone DNA of Mouse interleukin-1 receptor-associated kinase 2 with C terminal Myc tag.
NCBI Ref Seq NM_172161.4
RefSeq ORF Size 1869 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.