Online Inquiry
IQSEC2 Knockout Cell Line
SPL-01733
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 28bp deletion |
| Target Information | |
|---|---|
| Target Name | IQSEC2 |
| Gene Abbr. | IQSEC2 |
| Gene ID | 23096 |
| Full Name | IQ motif and Sec7 domain ArfGEF 2 |
| Alias | BRAG1, IQ-ArfGEF, MRX1, MRX18, MRX78 |
| Species | Human |
| Genomic Locus | chrX:53256010 |
| Transcript | NM_001111125 |
| WT Expression Level | 1.35 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked mental retardation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of IQSEC2. |
| Description | 28bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCACAGCGGTTGATAGTCCT |
| PCR Primer |
Forward: TGGAGAGTTCATAGCTGTCCGATA Reverse: TAAGTGTTGGGTCCCTATATCTGTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.