INSR cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

INSR cDNA ORF Clone, Human, untagged

INSR cDNA ORF Clone, Human, untagged

SPD-08693

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human insulin receptor transcript variant 1.
Target Information
Species Human
Target Name InsR
Gene Abbr. INSR
Gene ID 3643
Full Name insulin receptor
Alias CD220, HHF5
Introduction The heterotetrameric receptors for insulin (INS R) and IGF-I (IGF-I R) are receptor tyrosine kinases that consist of two ligand-binding alpha subunits and two beta subunits. Ligand binding induces autophosphorylation on multiple tyrosine residues of beta subunits. Phosphorylation of Tyr1162 and 1163 on INS R and Tyr1135 and 1136 on IGF‑I R stimulates intrinsic kinase activity.
Product Details
Description Full length Clone DNA of Human insulin receptor transcript variant 1.
NCBI Ref Seq NM_000208.2
RefSeq ORF Size 4149 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1650G/A,3042C/T,3255C/T not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 4.15kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.