Online Inquiry
INSR cDNA ORF Clone, Human, C-FLAG tag
SPD-08694
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human insulin receptor transcript variant 2 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | InsR |
Gene Abbr. | INSR |
Gene ID | 3643 |
Full Name | insulin receptor |
Alias | CD220, HHF5 |
Introduction | The heterotetrameric receptors for insulin (INS R) and IGF-I (IGF-I R) are receptor tyrosine kinases that consist of two ligand-binding alpha subunits and two beta subunits. Ligand binding induces autophosphorylation on multiple tyrosine residues of beta subunits. Phosphorylation of Tyr1162 and 1163 on INS R and Tyr1135 and 1136 on IGF‑I R stimulates intrinsic kinase activity. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human insulin receptor transcript variant 2 with C terminal Flag tag. |
NCBI Ref Seq | NM_001079817.1 |
RefSeq ORF Size | 4113 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1650G>A, 3042C>T not causing the amino acid variation., 3255C>T not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 4.15kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.