Online Inquiry
INS cDNA ORF Clone, Human, untagged
SPD-08734
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human insulin. |
Target Information | |
---|---|
Species | Human |
Target Name | Insulin |
Gene Abbr. | INS |
Gene ID | 3630 |
Full Name | insulin |
Alias | IDDM, IDDM1, IDDM2, ILPR, IRDN |
Introduction | The maintenance of glucose homeostasis is an essential physiological process that is regulated by hormones. An elevation in blood glucose levels during feeding stimulates insulin release from pancreatic β cells through a glucose sensing pathway. Insulin is synthesized as a precursor molecule, proinsulin, which is processed prior to secretion. A- and B-peptides are joined together by a disulfide bond to form insulin, while the central portion of the precursor molecule is cleaved and released as the C-peptide. Insulin stimulates glucose uptake from blood into skeletal muscle and adipose tissue. Insulin deficiency leads to type 1 diabetes mellitus. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human insulin. |
NCBI Ref Seq | NM_000207.2 |
RefSeq ORF Size | 333 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | KpnI + XbaI (6.1kb + 0.33kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.