INS cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

INS cDNA ORF Clone, Human, untagged

INS cDNA ORF Clone, Human, untagged

SPD-08734

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human insulin.
Target Information
Species Human
Target Name Insulin
Gene Abbr. INS
Gene ID 3630
Full Name insulin
Alias IDDM, IDDM1, IDDM2, ILPR, IRDN
Introduction The maintenance of glucose homeostasis is an essential physiological process that is regulated by hormones. An elevation in blood glucose levels during feeding stimulates insulin release from pancreatic β cells through a glucose sensing pathway. Insulin is synthesized as a precursor molecule, proinsulin, which is processed prior to secretion. A- and B-peptides are joined together by a disulfide bond to form insulin, while the central portion of the precursor molecule is cleaved and released as the C-peptide. Insulin stimulates glucose uptake from blood into skeletal muscle and adipose tissue. Insulin deficiency leads to type 1 diabetes mellitus.
Product Details
Description Full length Clone DNA of Human insulin.
NCBI Ref Seq NM_000207.2
RefSeq ORF Size 333 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.33kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.