Online Inquiry
INPPL1 Knockout Cell Line
SPL-01727
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 25bp deletion |
| Target Information | |
|---|---|
| Target Name | SHIP2 |
| Gene Abbr. | INPPL1 |
| Gene ID | 3636 |
| Full Name | inositol polyphosphate phosphatase like 1 |
| Alias | OPSMD, SHIP2 |
| Species | Human |
| Genomic Locus | chr11:72228404 |
| Transcript | NM_001567 |
| WT Expression Level | 141.93 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of INPPL1. |
| Description | 25bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTGGTTGGGCTGGGCGTAC |
| PCR Primer |
Forward: CTGATGGAGAAGATTTCTTGGCTGT Reverse: TTACAGGAGAGGTGGGGTTGAGAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.