Online Inquiry
INPP5E Knockout Cell Line
SPL-01721
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | INPP5E |
| Gene Abbr. | INPP5E |
| Gene ID | 56623 |
| Full Name | inositol polyphosphate-5-phosphatase E |
| Alias | CORS1, CPD4, JBTS1, MORMS, PPI5PIV |
| Species | Human |
| Genomic Locus | chr9:136434781 |
| Transcript | NM_019892 |
| WT Expression Level | 6.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of INPP5E. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTACTTCCCAGACCGGAACG |
| PCR Primer |
Forward: CTTACCCACTCTCACCCTCCTGTA Reverse: CTGACATTCCATGGGTTTTGCTATT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.