Impa1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Impa1 cDNA ORF Clone, Mouse, untagged

Impa1 cDNA ORF Clone, Mouse, untagged

SPD-08673

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse inositol (myo)-1(or 4)-monophosphatase 1
Target Information
Species Mouse
Target Name IMPA1
Gene Abbr. Impa1
Gene ID 55980
Full Name inositol (myo)-1(or 4)-monophosphatase 1
Alias 2610002K09Rik, 2900059K10Rik, AI325909
Product Details
Description Full length Clone DNA of Mouse inositol (myo)-1(or 4)-monophosphatase 1
NCBI Ref Seq NM_018864.6
RefSeq ORF Size 834 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.