Imp4 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Imp4 cDNA ORF Clone, Rat, untagged

Imp4 cDNA ORF Clone, Rat, untagged

SPD-08652

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast).
Target Information
Species Rat
Target Name IMP4
Gene Abbr. Imp4
Gene ID 316317
Full Name IMP U3 small nucleolar ribonucleoprotein 4
Alias LRRGT00017, RGD1308463
Product Details
Description Full length Clone DNA of Rat IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast).
NCBI Ref Seq NM_001009700.1
RefSeq ORF Size 876 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.