Online Inquiry
ILKAP Knockout Cell Line
SPL-01715
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 62bp insertion |
| Target Information | |
|---|---|
| Target Name | PP2C delta |
| Gene Abbr. | ILKAP |
| Gene ID | 80895 |
| Full Name | ILK associated serine/threonine phosphatase |
| Alias | ILKAP2, ILKAP3, PP2C-DELTA, PP2CD, PPM1O |
| Species | Human |
| Genomic Locus | chr2:238194278 |
| Transcript | NM_030768 |
| WT Expression Level | 36.66 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 62bp insertion in a coding exon of ILKAP. |
| Description | 62bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AATCGCCACTGCTAGCGGGT |
| PCR Primer |
Forward: TGCTTCCAATTAATGTGCCTGTTTA Reverse: TTATTCATTGCAGTATGAGTTGCCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.