Ilkap cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Ilkap cDNA ORF Clone, Mouse, untagged

Ilkap cDNA ORF Clone, Mouse, untagged

SPD-11785

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrin-linked kinase-associated serine/threonine phosphatase 2C.
Target Information
Species Mouse
Target Name PP2C
Gene Abbr. Ilkap
Gene ID 67444
Full Name integrin-linked kinase-associated serine/threonine phosphatase 2C
Alias 0710007A14Rik, 1600009O09Rik, PP2C-D, PP2C-DELTA
Introduction The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse integrin-linked kinase-associated serine/threonine phosphatase 2C.
NCBI Ref Seq NM_023343.2
RefSeq ORF Size 1179 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.