Online Inquiry
Ilkap cDNA ORF Clone, Mouse, C-FLAG tag
SPD-11776
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse integrin-linked kinase-associated serine/threonine phosphatase 2C with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | PP2C |
Gene Abbr. | Ilkap |
Gene ID | 67444 |
Full Name | integrin-linked kinase-associated serine/threonine phosphatase 2C |
Alias | 0710007A14Rik, 1600009O09Rik, PP2C-D, PP2C-DELTA |
Introduction | The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse integrin-linked kinase-associated serine/threonine phosphatase 2C with C terminal Flag tag. |
NCBI Ref Seq | NM_023343.2 |
RefSeq ORF Size | 1179 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.