Online Inquiry
ILK Knockout Cell Line
SPL-01713
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | ILK1 |
| Gene Abbr. | ILK |
| Gene ID | 3611 |
| Full Name | integrin linked kinase |
| Alias | HEL-S-28, ILK-1, ILK-2, P59, p59ILK |
| Species | Human |
| Genomic Locus | chr11:6604306 |
| Transcript | NM_004517 |
| WT Expression Level | 58.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of ILK. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACGCAGTCGCCGTTCGCCTG |
| PCR Primer |
Forward: CTCTCCTGTAGAGGATAAAGCTTGG Reverse: AGATCTCTAGCCTTCCTCTCATCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.