Ilk cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Ilk cDNA ORF Clone, Mouse, C-His tag

Ilk cDNA ORF Clone, Mouse, C-His tag

SPD-08593

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse integrin linked kinase with C terminal His tag.
Target Information
Species Mouse
Target Name ILK1
Gene Abbr. Ilk
Gene ID 16202
Full Name integrin linked kinase
Alias AA511515, ESTM2, ESTM24
Introduction Integrin-linked kinases (ILKs) couple integrins and growth factors to downstream pathways involved in cell survival, cell cycle control, cell-cell adhesion and cell motility. ILK functions as a scaffold bridging the extracellular matrix (ECM) and growth factor receptors to the actin cytoskeleton through interactions with integrin, PINCH (which links ILK to the RTKs via Nck2), CH-ILKBP and affixin. ILK phosphorylates Akt at Ser473, GSK-3 on Ser9, myosin light chain 2 (MLC2) on Ser18/Thr19, as well as affixin. These phosphorylation events are key regulatory steps in modulating the activities of the targets. ILK activity is stimulated by PI3 kinase and negatively regulated by the tumor suppressor PTEN and a PP2C protein phosphatase, ILKAP. It has been suggested that the conserved Ser343 residue in the activation loop plays a key role in the activation of ILK1.
Product Details
Description Full length Clone DNA of Mouse integrin linked kinase with C terminal His tag.
NCBI Ref Seq NM_001161724.1
RefSeq ORF Size 1359 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.