Online Inquiry
ILK cDNA ORF Clone, Human, N-His tag
SPD-08618
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human integrin-linked kinase with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | ILK1 |
Gene Abbr. | ILK |
Gene ID | 3611 |
Full Name | integrin linked kinase |
Alias | HEL-S-28, ILK-1, ILK-2, P59, p59ILK |
Introduction | Integrin-linked kinases (ILKs) couple integrins and growth factors to downstream pathways involved in cell survival, cell cycle control, cell-cell adhesion and cell motility. ILK functions as a scaffold bridging the extracellular matrix (ECM) and growth factor receptors to the actin cytoskeleton through interactions with integrin, PINCH (which links ILK to the RTKs via Nck2), CH-ILKBP and affixin. ILK phosphorylates Akt at Ser473, GSK-3 on Ser9, myosin light chain 2 (MLC2) on Ser18/Thr19, as well as affixin. These phosphorylation events are key regulatory steps in modulating the activities of the targets. ILK activity is stimulated by PI3 kinase and negatively regulated by the tumor suppressor PTEN and a PP2C protein phosphatase, ILKAP. It has been suggested that the conserved Ser343 residue in the activation loop plays a key role in the activation of ILK1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human integrin-linked kinase with N terminal His tag. |
NCBI Ref Seq | NM_001014794.1 |
RefSeq ORF Size | 1359 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.