IL9R cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

IL9R cDNA ORF Clone, Rhesus, untagged

IL9R cDNA ORF Clone, Rhesus, untagged

SPD-08580

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus interleukin 9 receptor.
Target Information
Species Rhesus
Target Name IL-9 Receptor
Gene Abbr. IL9R
Gene ID 704266
Full Name interleukin 9 receptor
Introduction Interleukin 9 Receptor (IL-9 R) belongs to the hematopoietin receptor superfamily and is the binding subunit of the heterodimeric IL-9 receptor complex. The other subunit is the common gamma chain shared with the receptors for IL-2, IL-4, IL-7, and IL-15. IL-9 R is expressed by T cells, neutrophils, mast cells, and macrophages.
Product Details
Description Full length Clone DNA of Rhesus interleukin 9 receptor.
NCBI Ref Seq XM_001100521.2
RefSeq ORF Size 1545 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.