Online Inquiry
Il9r cDNA ORF Clone, Rat, C-His tag
SPD-08582
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 9 receptor with C terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-9 Receptor |
Gene Abbr. | Il9r |
Gene ID | 24500 |
Full Name | interleukin 9 receptor |
Introduction | Interleukin 9 Receptor (IL-9 R) belongs to the hematopoietin receptor superfamily and is the binding subunit of the heterodimeric IL-9 receptor complex. The other subunit is the common gamma chain shared with the receptors for IL-2, IL-4, IL-7, and IL-15. IL-9 R is expressed by T cells, neutrophils, mast cells, and macrophages. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 9 receptor with C terminal His tag. |
NCBI Ref Seq | NM_017021.1 |
RefSeq ORF Size | 1404 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.