Online Inquiry
Il9 cDNA ORF Clone, Mouse, N-His tag
SPD-08556
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse interleukin 9 with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL-9 |
Gene Abbr. | Il9 |
Gene ID | 16198 |
Full Name | interleukin 9 |
Alias | Il, Il-9, P4, P40 |
Introduction | Human IL-9 was originally identified as a cytokine found in the conditioned medium of a human T cell leukemia virus type I (HTLV-I) transformed T cell line that is mitogenic for the factor-dependent human megakaryoblastic leukemic cell line, M07e. The cDNA encoding this cytokine was subsequently isolated by functional expression cloning and found to be similar to the mouse T cell growth factor III/P40. This human cytokine and its murine homologue are now designated as human and mouse IL-9. Besides HTLV-I or -II transformed T cell lines, rhIL-9 is also produced by activated human PBLs. Human IL-9 was also reported to be expressed by primary and cultured Hodgkin and Reed-Sternberg (H-RS) cells derived from Hodgkin's disease patients, suggesting a possible role for rhIL-9 in the development of the pathophysiology of Hodgkin's disease. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse interleukin 9 with N terminal His tag. |
NCBI Ref Seq | NM_008373.1 |
RefSeq ORF Size | 435 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.