Il9 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Il9 cDNA ORF Clone, Mouse, N-FLAG tag

Il9 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-08555

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 9 with N terminal Flag tag.
Target Information
Species Mouse
Target Name IL-9
Gene Abbr. Il9
Gene ID 16198
Full Name interleukin 9
Alias Il, Il-9, P4, P40
Introduction Human IL-9 was originally identified as a cytokine found in the conditioned medium of a human T cell leukemia virus type I (HTLV-I) transformed T cell line that is mitogenic for the factor-dependent human megakaryoblastic leukemic cell line, M07e. The cDNA encoding this cytokine was subsequently isolated by functional expression cloning and found to be similar to the mouse T cell growth factor III/P40. This human cytokine and its murine homologue are now designated as human and mouse IL-9. Besides HTLV-I or -II transformed T cell lines, rhIL-9 is also produced by activated human PBLs. Human IL-9 was also reported to be expressed by primary and cultured Hodgkin and Reed-Sternberg (H-RS) cells derived from Hodgkin's disease patients, suggesting a possible role for rhIL-9 in the development of the pathophysiology of Hodgkin's disease.
Product Details
Description Full length Clone DNA of Mouse interleukin 9 with N terminal Flag tag.
NCBI Ref Seq NM_008373.1
RefSeq ORF Size 435 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.