IL7R cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL7R cDNA ORF Clone, Human, untagged

IL7R cDNA ORF Clone, Human, untagged

SPD-08528

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 7 receptor.
Target Information
Species Human
Target Name IL-7 Receptor
Gene Abbr. IL7R
Gene ID 3575
Full Name interleukin 7 receptor
Alias CD127, CDW127, IL-7R-alpha, IL7RA, ILRA
Introduction IL-7R, or CD127, is often used to characterize regulatory T cells or Tregs. By phenotyping, IL-7R is inversely correlated with the high levels of the hallmark Treg transcription factor FoxP3. So lowered expression of IL-7R on the cell surface along with CD25 and CD4 in addition to FoxP3 internal expression is a major and routinely used technique for Treg cell studies. IL-7R residing on the surface enables enrichment and purification of Treg populations. Antibody to IL-7R is useful for phenotyping, identification, enumeration and purification of Tregs.
Product Details
Description Full length Clone DNA of Human interleukin 7 receptor.
NCBI Ref Seq NM_002185.2
RefSeq ORF Size 1380 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.38kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.