Online Inquiry
IL7R cDNA ORF Clone, Human, N-Myc tag
SPD-08526
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 7 receptor with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-7 Receptor |
Gene Abbr. | IL7R |
Gene ID | 3575 |
Full Name | interleukin 7 receptor |
Alias | CD127, CDW127, IL-7R-alpha, IL7RA, ILRA |
Introduction | IL-7R, or CD127, is often used to characterize regulatory T cells or Tregs. By phenotyping, IL-7R is inversely correlated with the high levels of the hallmark Treg transcription factor FoxP3. So lowered expression of IL-7R on the cell surface along with CD25 and CD4 in addition to FoxP3 internal expression is a major and routinely used technique for Treg cell studies. IL-7R residing on the surface enables enrichment and purification of Treg populations. Antibody to IL-7R is useful for phenotyping, identification, enumeration and purification of Tregs. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 7 receptor with N terminal Myc tag. |
NCBI Ref Seq | NM_002185.2 |
RefSeq ORF Size | 1380 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.