Il7 cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Il7 cDNA ORF Clone, Rat, N-HA tag

Il7 cDNA ORF Clone, Rat, N-HA tag

SPD-08497

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 7 with N terminal HA tag.
Target Information
Species Rat
Target Name IL-7
Gene Abbr. Il7
Gene ID 25647
Full Name interleukin 7
Introduction The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. This cytokine is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. Knockout studies in mice suggested that this cytokine plays an essential role in lymphoid cell survival.
Product Details
Description Full length Clone DNA of Rat interleukin 7 with N terminal HA tag.
NCBI Ref Seq NM_013110.2
RefSeq ORF Size 480 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 0.48kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.