Il7 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Il7 cDNA ORF Clone, Mouse, N-FLAG tag

Il7 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-08504

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 7 with N terminal Flag tag.
Target Information
Species Mouse
Target Name IL-7
Gene Abbr. Il7
Gene ID 16196
Full Name interleukin 7
Alias A630026I06Rik, Il, Il-7, hlb36, hlb368
Introduction The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. This cytokine is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. Knockout studies in mice suggested that this cytokine plays an essential role in lymphoid cell survival.
Product Details
Description Full length Clone DNA of Mouse interleukin 7 with N terminal Flag tag.
NCBI Ref Seq NM_008371.4
RefSeq ORF Size 465 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.48kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.