Il6st cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Il6st cDNA ORF Clone, Mouse, C-His tag

Il6st cDNA ORF Clone, Mouse, C-His tag

SPD-06183

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 6 signal transducer with C terminal His tag.
Target Information
Species Mouse
Target Name GP130
Gene Abbr. Il6st
Gene ID 16195
Full Name interleukin 6 signal transducer
Alias 5133400A03Rik, AA389424, BB405851, CD130, D13Ertd699
Introduction GP130 is a signal-transducing subunit shared by the receptors for the IL-6 family of cytokines. The binding of a ligand to its receptor induces the dimerization of GP130, leading to activation of the Jak tyrosine kinase and to tyrosine phosphorylation of GP130. These events lead to the activation of multiple signal-transduction pathways, such as the Stat, Ras-MAPK and PI3 kinase pathways, whose activation is controlled by distinct regions of GP130.
Product Details
Description Full length Clone DNA of Mouse interleukin 6 signal transducer with C terminal His tag.
NCBI Ref Seq NM_010560.2
RefSeq ORF Size 2799 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 2.8kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.