IL6R cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL6R cDNA ORF Clone, Human, untagged

IL6R cDNA ORF Clone, Human, untagged

SPD-08467

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 6 receptor, transcript variant 1.
Target Information
Species Human
Target Name IL-6 Receptor
Gene Abbr. IL6R
Gene ID 3570
Full Name interleukin 6 receptor
Alias CD126, HIES5, IL-6R-1, IL-6RA, IL6Q
Product Details
Description Full length Clone DNA of Human interleukin 6 receptor, transcript variant 1.
NCBI Ref Seq NM_000565.2
RefSeq ORF Size 1407 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.41kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.