Online Inquiry
Il6 cDNA ORF Clone, Rat, N-Myc tag
SPD-08424
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat interleukin 6 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | IL-6 |
Gene Abbr. | Il6 |
Gene ID | 24498 |
Full Name | interleukin 6 |
Alias | ILg6, Ifnb2 |
Introduction | Acute phase response is induced by interleukin-6 (IL-6) produced by T cells, macrophages, fibroblasts, endothelial and other cells. IL-6 induces proliferation or differentiation in many cell types including B cells, thymocytes and T cells. IL-6, in concert with TGF-β, is important for developing Th17 responses. IL-6 binds to IL-6Rα and through this association induces gp130 homodimerization. gp130 homodimerization triggers the Jak/Stat cascade and the SHP-2/Erk MAP kinase cascade. IL-6 also forms a complex with an IL-6Rα splice variant that is nonmembrane-associated. The IL-6/soluble IL-6Rα complex can then activate the gp130 signaling pathway in cells that express gp130 but not IL-6Rα. Research studies have shown that IL-6, through increasing expression of proangiogenic VEGF, may also contribute to metastatic breast cancer. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat interleukin 6 with N terminal Myc tag. |
NCBI Ref Seq | NM_012589.1 |
RefSeq ORF Size | 636 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.