Il6 cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Il6 cDNA ORF Clone, Rat, N-HA tag

Il6 cDNA ORF Clone, Rat, N-HA tag

SPD-08425

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 6 with N terminal HA tag.
Target Information
Species Rat
Target Name IL-6
Gene Abbr. Il6
Gene ID 24498
Full Name interleukin 6
Alias ILg6, Ifnb2
Introduction Acute phase response is induced by interleukin-6 (IL-6) produced by T cells, macrophages, fibroblasts, endothelial and other cells. IL-6 induces proliferation or differentiation in many cell types including B cells, thymocytes and T cells. IL-6, in concert with TGF-β, is important for developing Th17 responses. IL-6 binds to IL-6Rα and through this association induces gp130 homodimerization. gp130 homodimerization triggers the Jak/Stat cascade and the SHP-2/Erk MAP kinase cascade. IL-6 also forms a complex with an IL-6Rα splice variant that is nonmembrane-associated. The IL-6/soluble IL-6Rα complex can then activate the gp130 signaling pathway in cells that express gp130 but not IL-6Rα. Research studies have shown that IL-6, through increasing expression of proangiogenic VEGF, may also contribute to metastatic breast cancer.
Product Details
Description Full length Clone DNA of Rat interleukin 6 with N terminal HA tag.
NCBI Ref Seq NM_012589.1
RefSeq ORF Size 636 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.