Online Inquiry
Il6 cDNA ORF Clone, Mouse, untagged
SPD-08478
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse interleukin 6 receptor, alpha. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | IL-6 Receptor |
| Gene Abbr. | Il6ra |
| Gene ID | 16194 |
| Full Name | interleukin 6 receptor, alpha |
| Alias | CD126, I, IL, IL-6R, IL-6R-alpha |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse interleukin 6 receptor, alpha. |
| NCBI Ref Seq | NM_010559.2 |
| RefSeq ORF Size | 1383 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 T>C and 903 C>T not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.38kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.