IL6 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

IL6 cDNA ORF Clone, Human, N-FLAG tag

IL6 cDNA ORF Clone, Human, N-FLAG tag

SPD-08442

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 6 (interferon, beta 2) with N terminal Flag tag.
Target Information
Species Human
Target Name IL-6
Gene Abbr. IL6
Gene ID 3569
Full Name interleukin 6
Alias BSF-2, BSF2, CDF, HGF, HSF
Introduction Acute phase response is induced by interleukin-6 (IL-6) produced by T cells, macrophages, fibroblasts, endothelial and other cells. IL-6 induces proliferation or differentiation in many cell types including B cells, thymocytes and T cells. IL-6, in concert with TGF-β, is important for developing Th17 responses. IL-6 binds to IL-6Rα and through this association induces gp130 homodimerization. gp130 homodimerization triggers the Jak/Stat cascade and the SHP-2/Erk MAP kinase cascade. IL-6 also forms a complex with an IL-6Rα splice variant that is nonmembrane-associated. The IL-6/soluble IL-6Rα complex can then activate the gp130 signaling pathway in cells that express gp130 but not IL-6Rα. Research studies have shown that IL-6, through increasing expression of proangiogenic VEGF, may also contribute to metastatic breast cancer.
Product Details
Description Full length Clone DNA of Human interleukin 6 (interferon, beta 2) with N terminal Flag tag.
NCBI Ref Seq NM_000600.2
RefSeq ORF Size 639 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 0.64kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.