IL5RA cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

IL5RA cDNA ORF Clone, Human, N-HA tag

IL5RA cDNA ORF Clone, Human, N-HA tag

SPD-08395

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2 with N terminal HA tag.
Target Information
Species Human
Target Name IL-5 Receptor
Gene Abbr. IL5RA
Gene ID 3568
Full Name interleukin 5 receptor subunit alpha
Alias CD125, CDw125, HSIL5R3, IL5R
Introduction Human and mouse IL-5 R alpha are both members of the hematopoietin receptor superfamily characterized by the presence of the WSXWS, and a four cysteine residue motif in the extracellular domain of the transmembrane protein. In addition to the cDNA clone encoding the full-length transmembrane protein, cDNA clones that arise from alternative splicing and that encode soluble secreted forms of IL-5 R alpha have been isolated from mouse as well as human cells. A naturally-occurring soluble form of the IL-5 R alpha has been detected in biological fluids of autoimmune-prone mice and mice bearing chronic B cell leukemia (BCL1).
Product Details
Description Full length Clone DNA of Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2 with N terminal HA tag.
NCBI Ref Seq NM_175724.2
RefSeq ORF Size 1008 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.