Online Inquiry
IL5RA cDNA ORF Clone, Human, C-FLAG tag
SPD-08377
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 5 receptor, alpha (IL5RA), transcript variant 1 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-5 Receptor |
Gene Abbr. | IL5RA |
Gene ID | 3568 |
Full Name | interleukin 5 receptor subunit alpha |
Alias | CD125, CDw125, HSIL5R3, IL5R |
Introduction | Human and mouse IL-5 R alpha are both members of the hematopoietin receptor superfamily characterized by the presence of the WSXWS, and a four cysteine residue motif in the extracellular domain of the transmembrane protein. In addition to the cDNA clone encoding the full-length transmembrane protein, cDNA clones that arise from alternative splicing and that encode soluble secreted forms of IL-5 R alpha have been isolated from mouse as well as human cells. A naturally-occurring soluble form of the IL-5 R alpha has been detected in biological fluids of autoimmune-prone mice and mice bearing chronic B cell leukemia (BCL1). |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 5 receptor, alpha (IL5RA), transcript variant 1 with C terminal Flag tag. |
NCBI Ref Seq | NM_000564.3 |
RefSeq ORF Size | 1263 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + NotI (6kb + 1.31kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.