Online Inquiry
IL4R cDNA ORF Clone, Human, C-FLAG tag
SPD-08374
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 4 receptor |
Target Information | |
---|---|
Species | Human |
Target Name | IL-4 Receptor |
Gene Abbr. | IL4R |
Gene ID | 3566 |
Full Name | interleukin 4 receptor |
Alias | CD124, IL-4RA, IL4RA |
Introduction | Interleukin 4 receptor (IL-4 R) is the transmembrane ligand binding subunit of the heterodimeric IL-4 receptor complex. In the type I receptor complex, IL-4 R associates with the common gamma chain, whereas in the type II receptor complex, it associates with IL-13 R alpha 1. IL-4 R is expressed by B cells, T cells, monocytes and macrophages. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 4 receptor |
NCBI Ref Seq | NM_000418.3 |
RefSeq ORF Size | 2517 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 939T/C not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 2.52kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.