Online Inquiry
IL4 cDNA ORF Clone, Rhesus, C-His tag
SPD-08319
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rhesus interleukin 4 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Rhesus |
| Target Name | IL-4 |
| Gene Abbr. | IL4 |
| Gene ID | 574281 |
| Full Name | interleukin 4 |
| Introduction | Interleukin-4 (IL-4), also known as B cell-stimulatory factor-1, is a monomeric, approximately 13-18 kDa Th2 cytokine that shows pleiotropic effects during immune responses. It is a glycosylated polypeptide that contains three intrachain disulfide bridges and adopts a bundled four alpha -helix structure. Mouse IL-4 is synthesized with a 24 amino acid (aa) signal sequence. Mature mouse IL-4 shares 39%, 39%, and 59% aa sequence identity with bovine, human, and rat IL-4, respectively. Human, mouse, and rat IL-4 are species-specific in their activities. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rhesus interleukin 4 with C terminal His tag. |
| NCBI Ref Seq | NM_001032904.1 |
| RefSeq ORF Size | 507 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 291T/C not causing the amino acid variation. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 0.51kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.