IL3RA cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

IL3RA cDNA ORF Clone, Human, N-FLAG tag

IL3RA cDNA ORF Clone, Human, N-FLAG tag

SPD-08221

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 3 receptor, alpha (low affinity) with N terminal Flag tag.
Target Information
Species Human
Target Name IL-3 Receptor
Gene Abbr. IL3RA
Gene ID 3563
Full Name interleukin 3 receptor subunit alpha
Alias CD123, IL3R, IL3RAY, IL3RX, IL3RY
Introduction CD123 (Cluster of Differentiation 123), also known as Interleukin-3 receptor subunit alpha, is an Interleukin 3 specific subunit of a heterodimeric cytokine receptor. CD123 is a low affinity receptor to interleukin-3 and is composed of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3, colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5. The CD123 beta subunit is activated by the ligand binding, and is required for the biological activities of IL-3. A member of type I cytokine receptor family and type 5 subfamily, CD123 functions as a signaling cytokine known to stimulate cell proliferation, differentiation and survival. The gene for this protein maps within the X-Y pseudoautosomal region (PAR).
Product Details
Description Full length Clone DNA of Human interleukin 3 receptor, alpha (low affinity) with N terminal Flag tag.
NCBI Ref Seq NM_002183.2
RefSeq ORF Size 1137 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.17kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.