Online Inquiry
IL3RA cDNA ORF Clone, Canine, N-HA tag
SPD-08204
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine interleukin 3 receptor, alpha (low affinity) with N terminal HA tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | IL-3 Receptor |
Gene Abbr. | IL3RA |
Gene ID | 609293 |
Full Name | interleukin 3 receptor subunit alpha |
Introduction | CD123 (Cluster of Differentiation 123), also known as Interleukin-3 receptor subunit alpha, is an Interleukin 3 specific subunit of a heterodimeric cytokine receptor. CD123 is a low affinity receptor to interleukin-3 and is composed of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3, colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5. The CD123 beta subunit is activated by the ligand binding, and is required for the biological activities of IL-3. A member of type I cytokine receptor family and type 5 subfamily, CD123 functions as a signaling cytokine known to stimulate cell proliferation, differentiation and survival. The gene for this protein maps within the X-Y pseudoautosomal region (PAR). |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine interleukin 3 receptor, alpha (low affinity) with N terminal HA tag. |
NCBI Ref Seq | XM_846533.3 |
RefSeq ORF Size | 1128 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.