Il36g cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Il36g cDNA ORF Clone, Mouse, C-His tag

Il36g cDNA ORF Clone, Mouse, C-His tag

SPD-08298

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 1 family, member 9 with C terminal His tag.
Target Information
Species Mouse
Target Name IL-36
Gene Abbr. Il36g
Gene ID 215257
Full Name interleukin 36G
Alias IL-36gamma, If36g, Il1f9
Introduction Human interleukin 1 family member #9 [IL-1F9; also named Interleukin-36 gamma, IL36G, IL-1 epsilon (epsilon) and IL-1H1] is a member of the IL-1 family, which includes IL-1 beta, IL-1 alpha, IL-1ra, IL-18 and IL-1F5 through F10. All family members show a 12 beta -strand, beta -trefoil configuration, and are believed to have arisen from a common ancestral gene that has undergone multiple duplications. IL-1F9 is synthesized as a 19 kDa, 169 amino acid (aa) protein that contains no signal sequence, no prosegment and no potential N-linked glycosylation site. The molecule is secreted when transfected into 293-T cells.
Product Details
Description Full length Clone DNA of Mouse interleukin 1 family, member 9 with C terminal His tag.
NCBI Ref Seq NM_153511.2
RefSeq ORF Size 495 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.