Online Inquiry
IL36G cDNA ORF Clone, Human, C-Myc tag
SPD-08309
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 1 family, member 9 (IL1F9) with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-36 |
Gene Abbr. | IL36G |
Gene ID | 56300 |
Full Name | interleukin 36 gamma |
Alias | IL-1F9, IL-1H1, IL-1RP2, IL1E, IL1F9 |
Introduction | Human interleukin 1 family member #9 [IL-1F9; also named Interleukin-36 gamma, IL36G, IL-1 epsilon (epsilon) and IL-1H1] is a member of the IL-1 family, which includes IL-1 beta, IL-1 alpha, IL-1ra, IL-18 and IL-1F5 through F10. All family members show a 12 beta -strand, beta -trefoil configuration, and are believed to have arisen from a common ancestral gene that has undergone multiple duplications. IL-1F9 is synthesized as a 19 kDa, 169 amino acid (aa) protein that contains no signal sequence, no prosegment and no potential N-linked glycosylation site. The molecule is secreted when transfected into 293-T cells. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 1 family, member 9 (IL1F9) with C terminal Myc tag. |
NCBI Ref Seq | NM_019618.2 |
RefSeq ORF Size | 510 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.