IL36B cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

IL36B cDNA ORF Clone, Human, N-Myc tag

IL36B cDNA ORF Clone, Human, N-Myc tag

SPD-08294

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 1 family, member 8 (eta), transcript variant 2 with N terminal Myc tag.
Target Information
Species Human
Target Name IL-36
Gene Abbr. IL36B
Gene ID 27177
Full Name interleukin 36 beta
Alias FIL1, FIL1-(ETA), FIL1H, FILI-(ETA), IL-1F8
Introduction Human interleukin 1 family member #8 [IL-1F8; also named Interleukin-36 beta, IL36B, FIL-1 eta (eta) and IL-1H2] is a member of the IL-1 family of proteins. IL-1 family members include IL‑1 beta, IL-1 alpha, IL-1ra, IL-18 and IL-1F5 through F10. All family members show a 12 beta -stranded beta -trefoil configuration, and are believed to have arisen from a common ancestral gene that has undergone multiple duplications. Two alternatively spliced transcript variants encode distinct (164 or 157 residues) protein isoforms that differ in their C-terminal 70 amino acid (aa) residues have been reported. IL-1F8 isoform 2 is synthesized as a 157 aa protein that contains no signal sequence and no prosegment. Unlike IL-1F8 isoform 1 which lacks potential N‑linked glycosylation sites, isoform 2 contains one potential N-linked glycosylation site in its unique C-terminus. IL-1F8 is reported to be actively secreted.
Product Details
Description Full length Clone DNA of Human interleukin 1 family, member 8 (eta), transcript variant 2 with N terminal Myc tag.
NCBI Ref Seq NM_173178.1
RefSeq ORF Size 474 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.