Online Inquiry
IL36B cDNA ORF Clone, Human, N-FLAG tag
SPD-08292
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human interleukin 1 family, member 8 (eta), transcript variant 2 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | IL-36 |
Gene Abbr. | IL36B |
Gene ID | 27177 |
Full Name | interleukin 36 beta |
Alias | FIL1, FIL1-(ETA), FIL1H, FILI-(ETA), IL-1F8 |
Introduction | Human interleukin 1 family member #8 [IL-1F8; also named Interleukin-36 beta, IL36B, FIL-1 eta (eta) and IL-1H2] is a member of the IL-1 family of proteins. IL-1 family members include IL‑1 beta, IL-1 alpha, IL-1ra, IL-18 and IL-1F5 through F10. All family members show a 12 beta -stranded beta -trefoil configuration, and are believed to have arisen from a common ancestral gene that has undergone multiple duplications. Two alternatively spliced transcript variants encode distinct (164 or 157 residues) protein isoforms that differ in their C-terminal 70 amino acid (aa) residues have been reported. IL-1F8 isoform 2 is synthesized as a 157 aa protein that contains no signal sequence and no prosegment. Unlike IL-1F8 isoform 1 which lacks potential N‑linked glycosylation sites, isoform 2 contains one potential N-linked glycosylation site in its unique C-terminus. IL-1F8 is reported to be actively secreted. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human interleukin 1 family, member 8 (eta), transcript variant 2 with N terminal Flag tag. |
NCBI Ref Seq | NM_173178.1 |
RefSeq ORF Size | 474 bp |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.