Online Inquiry
Il36a cDNA ORF Clone, Mouse, N-His tag
SPD-08273
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse interleukin 1 family, member 6 with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL-36 |
Gene Abbr. | Il36a |
Gene ID | 54448 |
Full Name | interleukin 1 family, member 6 |
Alias | Fi, Fil, Fil1, IL-1, IL-1H1 |
Introduction | Human interleukin 1 family member #6 [IL-1F6; also Interleukin-36 alpha, IL36A, FIL-1 epsilon (epsilon)] is a member of the IL-1 family of proteins. IL-1 family members include IL-1 beta, IL-1 alpha, IL‑1ra, IL-18 and IL-1F5 through F10. All family members show a 12 beta -strand, beta -trefoil configuration, and all family members are believed to have arisen from a common ancestral gene that has undergone multiple duplications. IL-1F6 is synthesized as a 158 amino acid (aa) protein that contains no signal sequence, no prosegment and no potential N-linked glycosylation site(s). It appears to be actively secreted. When found in cell lysate, it presents as an 18 kDa monomer. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse interleukin 1 family, member 6 with N terminal His tag. |
NCBI Ref Seq | NM_019450.3 |
RefSeq ORF Size | 483 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.