Il36a cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Il36a cDNA ORF Clone, Mouse, N-His tag

Il36a cDNA ORF Clone, Mouse, N-His tag

SPD-08273

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 1 family, member 6 with N terminal His tag.
Target Information
Species Mouse
Target Name IL-36
Gene Abbr. Il36a
Gene ID 54448
Full Name interleukin 1 family, member 6
Alias Fi, Fil, Fil1, IL-1, IL-1H1
Introduction Human interleukin 1 family member #6 [IL-1F6; also Interleukin-36 alpha, IL36A, FIL-1 epsilon (epsilon)] is a member of the IL-1 family of proteins. IL-1 family members include IL-1 beta, IL-1 alpha, IL‑1ra, IL-18 and IL-1F5 through F10. All family members show a 12 beta -strand, beta -trefoil configuration, and all family members are believed to have arisen from a common ancestral gene that has undergone multiple duplications. IL-1F6 is synthesized as a 158 amino acid (aa) protein that contains no signal sequence, no prosegment and no potential N-linked glycosylation site(s). It appears to be actively secreted. When found in cell lysate, it presents as an 18 kDa monomer.
Product Details
Description Full length Clone DNA of Mouse interleukin 1 family, member 6 with N terminal His tag.
NCBI Ref Seq NM_019450.3
RefSeq ORF Size 483 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.