Il33 cDNA ORF Clone, Rat, N-His tag - CD BioSciences

service-banner

Il33 cDNA ORF Clone, Rat, N-His tag

Il33 cDNA ORF Clone, Rat, N-His tag

SPD-08252

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat interleukin 33 with N terminal His tag.
Target Information
Species Rat
Target Name IL-33
Gene Abbr. Il33
Gene ID 361749
Full Name interleukin 33
Alias RGD1311155
Introduction Interleukin 33 (IL-33) is a 32kDa proinflammatory cytokine and intracellular nuclear factor with transcriptional regulatory properties. IL-33 is structurally related to IL-1, which induces helper T cells to produce type 2 cytokines and acts through the receptor IL1RL-1 (IL1 receptor-like-1), which is known also as ST2. Binding of IL-33 to this receptor activates NF-kappa-B and MAP kinases and induces in vitro Th2 cells to produce cytokines. In vivo, IL-33 induces expression of IL-4, IL-5, IL-13 and leads to severe pathological changes in mucosal organs and in vitro, it can be divided to N-terminal fragment of 12kDa and C-terminal fragment of 18kDa by cleavage of caspase-1.
Product Details
Description Full length Clone DNA of Rat interleukin 33 with N terminal His tag.
NCBI Ref Seq NM_001014166.1
RefSeq ORF Size 795 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.