Online Inquiry
IL33 cDNA ORF Clone, Canine, C-FLAG tag
SPD-08236
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine interleukin 33 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | IL-33 |
Gene Abbr. | IL33 |
Gene ID | 403810 |
Full Name | interleukin 33 |
Introduction | Interleukin 33 (IL-33) is a 32kDa proinflammatory cytokine and intracellular nuclear factor with transcriptional regulatory properties. IL-33 is structurally related to IL-1, which induces helper T cells to produce type 2 cytokines and acts through the receptor IL1RL-1 (IL1 receptor-like-1), which is known also as ST2. Binding of IL-33 to this receptor activates NF-kappa-B and MAP kinases and induces in vitro Th2 cells to produce cytokines. In vivo, IL-33 induces expression of IL-4, IL-5, IL-13 and leads to severe pathological changes in mucosal organs and in vitro, it can be divided to N-terminal fragment of 12kDa and C-terminal fragment of 18kDa by cleavage of caspase-1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine interleukin 33 with C terminal Flag tag. |
NCBI Ref Seq | NM_001003180.1 |
RefSeq ORF Size | 801 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.